EST details — SGN-E280843

Search information 
Request: 280843Match: SGN-E280843
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59857Clone name: cLEL-6-J8
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59857 [cLEL-6-J8] Trace: SGN-T17418 EST: SGN-E234640 Direction: 3' Facility: Cereon
Clone: SGN-C59857 [cLEL-6-J8] Trace: SGN-T17898 EST: SGN-E235120 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280843Length: 290 bp (1067 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280843 [] (trimmed) GCTTAATGCTCATGATTCGCATCATACACCAGCACCAGCTGAGAATGTTCAGGCGCCGAATTCCATCAATGGATTCATACTTAGACAAGGTCAAT
ATTGCTTTATGGCCACGTTTCAAGATGGTCTTTGACTTGCACCTCCACAGCCTGCGAAATGCCAATATCAGGACTCTCTGGGAAGATGATGTTCA
CCCACATTATGTCATAAGGCGCTATGCTGAGTTTTCTGCGTCCCTTATTCACCTTAATGTAGAATACAAAGATGGCCAGCTTGAACTGAATCTGG
AGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280843] SGN-U588169 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22290 [Download][View] Facility Assigned ID: tomato060452.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0241 Quality Trim Threshold: 14.5