Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E281972

Search information 
Request: 281972Match: SGN-E281972
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77519Clone name: cLES-2-E20
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183525 is on microarray TOM1: SGN-S1-1-6.3.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183525 [TUS-42-G11] Trace: SGN-T196120 EST: SGN-E394794 Direction: 3' Facility: INRA
Clone: SGN-C183525 [TUS-42-G11] Trace: SGN-T200241 EST: SGN-E399152 Direction: 3' Facility: INRA
Clone: SGN-C183525 [TUS-42-G11] Trace: SGN-T200242 EST: SGN-E399153 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281972Length: 397 bp (609 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281972 [] (trimmed) TCTTTATAAGGACATAAAAAGTTGTGTTACAATTTATTTCAAAGTTAGCACCACGGAGCACACTAGCAAGCAGCCAATATGTCCTATGACCAATT
GCTACAACACTTGTGCTACTCACTATTTTTTTCGTAAACAAAATTCAACAAACTGTATAATAAGAAACAACATATAGTAGTAGTATAGTAACATT
GGTAAATGAACAGTTTCTAGACTCTAGTAGTACTATTTTTTTCAAATTCCCAACTGACTCTGCACTTCCAAAATAGTCTTAGCTGAATTCCTAAG
CTGTTCAATTTCTTCATCAGTAAGATGCACATTCGTCACGCCCAAAACTCCACTTCTACCAAGCTGTGCAGGCAAGCTCAAGAACACATCGCCAC
CATCAATGCCATAGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281972] SGN-U580703 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97132 [Download][View] Facility Assigned ID: TPSAF34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5