Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E282610

Search information 
Request: 282610Match: SGN-E282610
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70672Clone name: cLER-15-I5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178783 is on microarray TOM1: SGN-S1-1-4.1.2.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178783 [TUS-30-A21] Trace: SGN-T184324 EST: SGN-E371710 Direction: 3' Facility: INRA
Clone: SGN-C178783 [TUS-30-A21] Trace: SGN-T184325 EST: SGN-E371711 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282610Length: 168 bp (794 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282610 [] (trimmed) CTTGCTTGAAAATCCTGAAGTGGCTTTGGATGCTCTTTCTATTTGCATGTCAATTTCTGGTTGGGTCTTCATGATATCAGTTGGATTCAATGCAG
CAGCAAGTGTGAGAGTGAGCAATGAACTAGGAGCAAGGCATCCCAAATCAGCCGCGTTTTCTGTTGTCGTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282610] SGN-U572132 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95130 [Download][View] Facility Assigned ID: TPRCE51THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0004 Quality Trim Threshold: 14.5