EST details — SGN-E282701

Search information 
Request: 282701Match: SGN-E282701
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70770Clone name: cLER-15-N19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178816 is on microarray TOM1: SGN-S1-1-3.3.3.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178816 [TUS-30-C6] Trace: SGN-T184569 EST: SGN-E371955 Direction: 3' Facility: INRA
Clone: SGN-C178816 [TUS-30-C6] Trace: SGN-T184570 EST: SGN-E371956 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282701Length: 432 bp (755 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282701 [] (trimmed) AACCTATAAATAGTAGATCTTGGCTTCATAGTACTCATTTCTTAGTAGTTTTTTACACAATACCAAATGTTATTTCCATATATGGGCTTAGCTAG
ACTTTAGAGATTAAAAATAGATATCGAGGCTTCATAGGCTAAACGGGGGGTGGGGATTTAGCTAGATGCATTAGCTCTGATTTTGGGTATAAGGG
TCTTAGCAGCCTCAGCAAGCTTATTAGTTTCAGGCATGACATTTTTGACAGAACTATCAGCACAAAAATTTTCAGCCCAATTGTATAAACCTGGA
GTCTTGGCTTCATCAAGTAGGGTGACGTTGTTCATTTTTTCGATCACCCTCATCCAACCTAAGAAGCATCCAAGTGCAATGTCCACGTATCCAAT
TTTGTCTCCGCCAAAGAACTTCTTTCCTTTGCTGCAATTCTTGAAGGCGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282701] SGN-U574510 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95221 [Download][View] Facility Assigned ID: TPRCG82THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0166 Quality Trim Threshold: 14.5