EST details — SGN-E282890

Search information 
Request: 282890Match: SGN-E282890
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70505Clone name: cLER-15-B14
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282890Length: 328 bp (767 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282890 [] (trimmed) CCACTTTCAAGAAGGGTAAGCCTGATCTGCGGAAGAAGGTTATGCCTGCTGTCATTGTTCGTCAGCGCAAGCCATGGCGTCGAAAGGATGGTGTT
TTCATGTACTTTGAAGATAATGCTGGTGTAATTGTGAATCCCAAGGGTGAAATGAAGGGTTCTGCTATTACTGGTCCTATCGGAAAAGAGTGTGC
TGATCTGTGGCCCAAGATTGCAAGCGCTGCCAACGCTATCGTGTAGTTTTAAATTGGGTGTTTTCCAAGATTGCCAACACTGCTATTCTTAAATA
TGTGCTTTTCTGAATAGTGATCCATTTTAACTTTTTGGGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282890] SGN-U580720 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95410 [Download][View] Facility Assigned ID: TPRCH07THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0298 Quality Trim Threshold: 12.5