Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E282962

Search information 
Request: 282962Match: SGN-E282962
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71156Clone name: cLER-17-A18
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282962Length: 367 bp (883 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282962 [] (trimmed) AAAAACTCAACAAACGCATCTTCAAACTTGTTAGGCGAGCTGCTGAGAAAAAATGCTTGAAGAGGGGCGTTAAAGAGGTGGTGAAGAGTATTCGA
CGAGGTCAAAAAGGAGTGTGTATCATAGCTGGAAATATATCTCCTATAGATGTCATCACTCATGTTCCAATCCTCGATGTTCTGAGTATCAACAA
CATTAGGATATCGGAGTTTGTACCTAATTCCCTACTATTCAAAACTTTTGTATGGCTCTCTAGTATTAGTCTTTCCAATCTGAGCTACTTCTTTC
TTCCCCTTGCTCTAAATTCTGGAACATGATTCATAGCTGCTGCTATGCATTGATATCCAAGTGTTGCTCTATCGTGTGTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282962] SGN-U593654 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95813 [Download][View] Facility Assigned ID: TPRCN09THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0014 Quality Trim Threshold: 12.5