Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E283190

Search information 
Request: 283190Match: SGN-E283190
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71382Clone name: cLER-17-L11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178904 is on microarray TOM1: SGN-S1-1-3.2.2.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178904 [TUS-30-F22] Trace: SGN-T184935 EST: SGN-E372143 Direction: 3' Facility: INRA
Clone: SGN-C178904 [TUS-30-F22] Trace: SGN-T184936 EST: SGN-E372144 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283190Length: 509 bp (802 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283190 [] (trimmed) CTAGAAATGGCTGATCGTTCTAATATTCCAATTCTACGTCACCGAAGCACAACCTAATTTCACTTTTCAATCGCCCTGTGAAGGTAATGTGACAG
AGTACCCTCTAAATGGTACATACCACACAAACCTTAACACACTTCTCTCCTCTCTTTCACGTAACATAGACAGAGATGGCTTCTATAATGCTACC
GTAAGCCAAGATCAGAACAGGGTTAGTGCCATCGCGCAATGTAGAGCAGATGTTGAACTACAAACATGCCGCAGCTGTATAAATAATGCTACTCG
CTTGATTATAGAGAAATGTCCTTCCAAGAAATCAGCCTTTGGCATTTATGATATGTGTCTCATAAGATATTCAAATGAGTGCTTCAGTTTGATCA
AACTTATAGACTTTCTGGCCTATTCTTCAAAGGAAAACATAGTCTTTATTAGATCACGGGTCCTCCATCTTTTGTCACTCTCAACTTCAACTACC
ATTCAATTGCCAACCAAATCACGTCCTTAAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283190] SGN-U583045 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96041 [Download][View] Facility Assigned ID: TPRCO66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0175 Quality Trim Threshold: 14.5