EST details — SGN-E283367

Search information 
Request: 283367Match: SGN-E283367
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69885Clone name: cLER-12-O15
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189877 [TUS-58-P3] Trace: SGN-T340144 EST: SGN-E539269 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189877 [TUS-58-P3] Trace: SGN-T340146 EST: SGN-E539271 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283367Length: 547 bp (832 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283367 [] (trimmed) CTGGCATTTTCAGATGGGTTGTTGATTCTGGTGAATTCTTTGTGTGTGATTGAAGAACCAAAGAAAAGTTGAATCAGTTTGTGGGACTCTTCGTT
TTACTGAACATGAATCAAGCACATCGATATGGCGAAGCTCAAGATGAAGCTATCGTGACAGGTTTCGAGATACCAACATCACCTGATGTAAGTTA
CAACAACGTTCATCCTGGAAATGAAGATGATGCTCGTGAACCACCAATGGTTCCACAACAGCTGCACACTACTGTATTGAACCACCCCAGTGTGA
CTAGGGATCAGTCTGCAGAGCTTCCATCACCACAACATGTGGTTCTAAACCATCTCTACCTTGAGGACAGACAAGCCCAGGGACCAGTCGTGGCA
GTCGGTGTAACTTCTCGTTTTCGCTCAAAGTTTGTTACCGTTGTGCTTTACAAACCAGCTGAAAGGAGAAGAGGAAGTACCAGCAATGCCTGATT
GTTCGTTCTGATGGAAACAATAGATAGAAAGGTAAATACAAAGCAATTGATCCGCAAGAAATCGTTTATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283367] SGN-U582516 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94334 [Download][View] Facility Assigned ID: TPRBS92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5