Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E283434

Search information 
Request: 283434Match: SGN-E283434
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69753Clone name: cLER-12-H5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189856 [TUS-58-O6] Trace: SGN-T340108 EST: SGN-E539233 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189856 [TUS-58-O6] Trace: SGN-T340110 EST: SGN-E539235 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283434Length: 469 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283434 [] (trimmed) GAAGTACGCCATAGAAGCAACGAAGGTAGAAAAAAAAATGGAGGACGATAGGATTCTAGAGAGAGAAAGGTATCAAATGGAGCAAATACGGGAGC
TTGAATCGGAGGAATTGCAAGTTGAGGAAGTCGATGAAGAATCATCAGACGATGAAACTAATTACCGTAGTTCGGGGGGAGCATCTGCATCTGGT
GAATTTACTTACAACACCTCTCTGGCTGCCTTACATTCTTACCTTGGTGATGTTGAAGATACTCATAACAGGCTGGCCTTCTTGGATGGAGGAGC
TGTCTTAAATGTTCCTCTGTTCTATCTAGAAGGAGTTGTTTTATTTCCCGAGGCCACACTTCCTTTGCGAGTCATTCAGCCTAATTTTATAGCTT
CTGTTGAAAGAGCACTGAGGCAAGTTGATGCTCCTTACATAATCGGCGTGATCCGAGTTTACAAGGATCCCAAATATGGAAGGATTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283434] SGN-U572825 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94401 [Download][View] Facility Assigned ID: TPRBU39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5