EST details — SGN-E284749
| Search information |
| Request: 284749 | Match: SGN-E284749 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C77982 | Clone name: cLES-3-O21 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E284749 | Length: 326 bp (801 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E284749 [] (trimmed)
TTCTTTTGGATGCATAGTCGAATTCAAATGCAAAAGAAAACAGAGATAGTACTAGTAATTCTTTGGCACAAAACCACATGAATTTCACATAAAAT
CAGTTAACAAAAACACATATAGTAAATATATTTTTGTTTGATATTCAGCCAAAGAAACTGGGATCATATCCATTGCTAGAAGTAGCAAGGATATA
ATAAGCAACAATATGTCCAATAGATCCCCAAGCAAGCACATCAACAATATTGAATCCAACTGGATCATTTGATTTTAACAAACTTATATATTCCT
TAGCCCTAACATCTCCAGCTTTAAAGTGAGAAATTCCATTT
CAGTTAACAAAAACACATATAGTAAATATATTTTTGTTTGATATTCAGCCAAAGAAACTGGGATCATATCCATTGCTAGAAGTAGCAAGGATATA
ATAAGCAACAATATGTCCAATAGATCCCCAAGCAAGCACATCAACAATATTGAATCCAACTGGATCATTTGATTTTAACAAACTTATATATTCCT
TAGCCCTAACATCTCCAGCTTTAAAGTGAGAAATTCCATTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E284749] | SGN-U596198 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T97770 [Download][View] | Facility Assigned ID: TPSAI95TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.896 | Expected Error Rate: 0.0030 | Quality Trim Threshold: 14.5 |


