EST details — SGN-E284957
| Search information |
| Request: 284957 | Match: SGN-E284957 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C71826 | Clone name: cLER-19-E1 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C190030 [TUS-59-F12] | Trace: SGN-T340407 | EST: SGN-E539532 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C190030 [TUS-59-F12] | Trace: SGN-T340409 | EST: SGN-E539534 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E284957 | Length: 170 bp (917 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E284957 [] (trimmed)
CACCCAAAATTAATACCTTGAAATCGCAAACCCTAAACAAACCATGGAAGAAATCAAGTGAATTGGGTTACAGGAGGATGATGTATGTAGTGGTA
CCCAAAGTAGTTCCGGATAAGAAGCTATCTGATTTATTTGCGGAAAGAGGTAAAGAATCTGAATAAACTTGTGCG
CCCAAAGTAGTTCCGGATAAGAAGCTATCTGATTTATTTGCGGAAAGAGGTAAAGAATCTGAATAAACTTGTGCG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E284957] | SGN-U587198 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T96529 [Download][View] | Facility Assigned ID: TPRCU25TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.947 | Expected Error Rate: 0.0349 | Quality Trim Threshold: 14.5 |
Working
