EST details — SGN-E288086

Search information 
Request: 288086Match: SGN-E288086
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78912Clone name: cLES-7-C9
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190240 [TUS-59-O6] Trace: SGN-T340767 EST: SGN-E539892 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190240 [TUS-59-O6] Trace: SGN-T340770 EST: SGN-E539895 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288086Length: 529 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288086 [] (trimmed) GTCGAATCAAGAAGAAGATTACGGCGTGTTGTTATACTACAAGTACGCCACCATTCCCGATCTTGAAGCACTATTCAACTTCTACGAGTCCAATT
GCAAGTGTCTTTCCCTCCTGGGTCGTGTCCGCCTCTCTCACAATGGCGTAAATGTCACTGTTGGGGGCAAGTTATCTGCTTTGGAGGAGCACATT
GCTGCAGTGAAGTTGAATTGTTTGTTTGAAGGGACAGACTTTAAGCTTGCTTCTTGCCATGAACCATCAAATGATAGGGTCGCCGTGGAATGTGG
ATTTACTTCCCTGTCCATACGTATAGTTAAGGAATTGGTAACTTTAAGTTCCTGTCCCCTGCCAAGTTCACCTCCTGATATTTCAAATGCGGGGA
AGCATCTATCTGCAGCTGAATTCCACTCTGTCCTTCACAATGTTGGGAACTCTCAAGACAAACTGATTCCAAGCAGCGATAAAGGAACTGTCCTT
ATTGATGCAAGGAATTTATATGAGACTAGAATCGGGAAGTTTTATACTCCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288086] SGN-U584509 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98842 [Download][View] Facility Assigned ID: TPSAY17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5