EST details — SGN-E288622

Search information 
Request: 288622Match: SGN-E288622
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79423Clone name: cLES-8-O21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190313 [TUS-60-B7] Trace: SGN-T340893 EST: SGN-E540018 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190313 [TUS-60-B7] Trace: SGN-T340895 EST: SGN-E540020 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288622Length: 408 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288622 [] (trimmed) CCTGGTTATTCATCAAGCCACTGCTACTCCTATCTTATACGACTTCTACAACTACGATGTTGACAAGAAAGAATTTGCTCAACTTCTTGTCAAGT
TTACTCAGAGCTTGGCACTCCTTGGTGCACTGTTCTTTTTTATTGGCATGAAGAACTCTACCAAGAGATCCTTCTCTTTGTCTTTGGTAGCTCTC
TTGGAGCTATAATCCTGGTTATTCATCAAGCCATTGCTACTCCCAAGACAAAAACAGGTTAAGGGATATGAGACATTGAGAGATGTTTCAATTTT
GCTGTGATCGATTTGCAGCATGCCATACCCCTTTGAAGAGTTTCTTGTAAGCTTTGTATTTTGCAATTTTACTTTGGTTAAATTTCCCAACTTTG
TAGCTTCGATTTTGTTTGATTGATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288622] SGN-U590292 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99142 [Download][View] Facility Assigned ID: TPSBC95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0179 Quality Trim Threshold: 12.5