EST details — SGN-E289936

Search information 
Request: 289936Match: SGN-E289936
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88735Clone name: cLET-9-F21
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190797 [TUS-61-F11] Trace: SGN-T341724 EST: SGN-E540849 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190797 [TUS-61-F11] Trace: SGN-T341727 EST: SGN-E540852 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289936Length: 249 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289936 [] (trimmed) TTGCAGAACAGAAAGCCAGAGAAGCAGTTGCAATGCGGTCAAAGGTTCAGAAAGAGATGATGATGAAAGAAAAGGAGAAGAAAGAGATAGAACTT
CGGGAGTTGGCCCGCAAGGCAAGATCTGATAGATTGGTTGGGGTACCTTCAGCTGCTGCACATGTACCTTCTGAGAGGGACTCCAGGAATGTTGA
TGATATGAATGAGGACTATGAGCGAGCAAGAGATTTGCCCAAAGAATCAAGGGGGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289936] SGN-U580158 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104751 [Download][View] Facility Assigned ID: TMEBI35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0165 Quality Trim Threshold: 14.5