Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E290139

Search information 
Request: 290139Match: SGN-E290139
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87718Clone name: cLET-5-J22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190698 [TUS-61-B8] Trace: SGN-T341554 EST: SGN-E540679 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190698 [TUS-61-B8] Trace: SGN-T341557 EST: SGN-E540682 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290139Length: 518 bp (643 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290139 [] (trimmed) ATCAGGCCCAATTGCTAGTAGATCAAGCAATTTTTCATTGAGTTTTAGGGCCCATATTGAGCCCAATTCAAAAAATAATAGTAGTAGCACAACAA
GCCTTTTGATCCAACAAAAAGATTCAAGACAACAAGATCCATATGGTATTTTTGATTCAGAAGAGTCCATTCCAAGAGATATTGGGCCTTACAAA
AATTTGGTTAGATTTGCATCAACATCTATGGAGCCCAAATGCATCTCAAATTCTAACTCTATTCCTCTATTTCAAAAGCTCAAGCTTATGATGAA
CAGTCTACAAAATGTAGATTTAAGATTGCTGAATTATCAACAGAAATTAGCATTCTGGATCAACATGTACAACGCTTGTATCATGGATTTCTTCA
ACATGGACTTCCTTCTAGTTCTACTCCAGAAAAGTTATTGTCACTTATGAATAAGGCAACTCTGAATATTGGTGGAAATACAATAAATGCACATG
CAATTGAACATTTTATTTTGAGAAAACCAGTAAATTCACTAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290139] SGN-U598103 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103587 [Download][View] Facility Assigned ID: TMEAT59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5