Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E291749

Search information 
Request: 291749Match: SGN-E291749
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87919Clone name: cLET-6-F20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190710 [TUS-61-B20] Trace: SGN-T341575 EST: SGN-E540700 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190710 [TUS-61-B20] Trace: SGN-T341577 EST: SGN-E540702 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291749Length: 354 bp (950 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291749 [] (trimmed) GGGGCAAAATGAACATTTTTCCTTTTTATAAAAAAAATTTTTTAACAAAAAAAGGTTTTTTCAGGTCACATTTCAATTTACTTTTGGCAAAGGGG
AAACAAAATTTGGGGGTCCAAAAGCTGCAGAGCCCCCACCAACCGAAGGTTGAGCACCCACACTTTGCAAACCGGTTTGCCAAGGGTAATTTTCC
GGCCCCAAATTCCCCCAAACGGGGCCCCCAGCCAACAATCCCAAACTAAAACTGAAAAGTGCTTTTGGAGTTAAAGGGTCAATATCTGTTGAAAA
AATCCCCAATTTTTCGGTTTTTGAAAGAAAACCAAGTCTTTCAATGGGGGATAAAAAGAGGCCAAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291749] SGN-U602541 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104002 [Download][View] Facility Assigned ID: TMEAX34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.856 Expected Error Rate: 0.0321 Quality Trim Threshold: 12.5