EST details — SGN-E292037

Search information 
Request: 292037Match: SGN-E292037
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88184Clone name: cLET-7-F10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190733 [TUS-61-C19] Trace: SGN-T341614 EST: SGN-E540739 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190733 [TUS-61-C19] Trace: SGN-T341617 EST: SGN-E540742 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292037Length: 298 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292037 [] (trimmed) GTTTTACCCATCTGATCTCAGTTTTCCAGCTCGAAAACCACACGGTAACTAACGTAAGTTGAACGAACCCTGCCCTAAACTCTTTAGTCAACAAT
GGCTTCTCTGTCCAGATTTATTGGGAAACAATGTAAATGCAGGTTCAACCACTTAAGACCAAGTATGGGTTTGGTTAGAAGGAGCCACCCATTGA
GTTGGGTATGAAATGAGATGAATGAAATATAATTGTCATCAATCAAAATCAAAGTAACTTCCTAGTTCAATCCCCGGCAATCCAAATATATGTTG
GAGGACATCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292037] SGN-U568384 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104290 [Download][View] Facility Assigned ID: TMEBB29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0235 Quality Trim Threshold: 14.5