Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E292345

Search information 
Request: 292345Match: SGN-E292345
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82222Clone name: cLET-1-E24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179427 is on microarray TOM1: SGN-S1-1-8.4.2.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179427 [TUS-31-L17] Trace: SGN-T185504 EST: SGN-E373366 Direction: 3' Facility: INRA
Clone: SGN-C179427 [TUS-31-L17] Trace: SGN-T185505 EST: SGN-E373367 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292345Length: 582 bp (878 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292345 [] (trimmed) GATGATCTCAACACTATATAAAGAGCCATTATATACACATTAATCAGCAAACACAGCTTATCTACTGGTGTTTGTTTCCCATCTTTTCACAATAG
ATAAAACATCAGATTTATTTACAAGGAAAGTACTTTTGGAACAGAACTATCTCGGCCTACTTTCTGTTTTCAGAAAGCGGACATATTCCTGCTGT
ACCATTTCTCCTCCATTCACAGGATCGAAGCTGCACCTATAGAAACTTCCATCAGTGCCAGCAGCTATAATGGTGTTCTGAGAACCAAATGCAGC
AATGTACTGGGTACATTCTGGCGAATGAAATTGAGCAAATGACCATTCAGAGCTAAAGTATTTTGGCAGAACTCCTTTCATGAAAGACAGTGATG
AACCAGGGTTGGCTCCAGTACTTGGAGAAATAAGTGCATCAAGAGAAGATGATGAATTCTGACACAACAATGTTGGAGTTCTAACAGCAGCATCA
GCTGAAGCATCCTCTCCAACAACACGTACTCTAAGGCTGTATACATGGATAGTACCTTTGGCGCTCGAGACGACCAACCACTGAACATTTGGTGA
TAGAGCAATACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292345] SGN-U575065 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102619 [Download][View] Facility Assigned ID: TMEAB36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5