EST details — SGN-E294176

Search information 
Request: 294176Match: SGN-E294176
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80812Clone name: cLET-13-H20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190860 [TUS-61-I2] Trace: SGN-T341832 EST: SGN-E540957 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190860 [TUS-61-I2] Trace: SGN-T341835 EST: SGN-E540960 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294176Length: 471 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294176 [] (trimmed) TCTCGATACTGTTTTCGATCCTCTTAGAGATTTCGCCAAAGACAGCGTAAGGCTCGTCAAAAGGTGCCACAAGCCTGATCGCCGTACGGGTTGCA
ACCTTGGTAAATTCTTTGAAGAGGTGGAAAATAAGCAAGAAATCCCAGTTCCAGCACCAGCAACATTACCTCCTGTAGAAACTACCAAAACCAAT
GCATTTTCGGTGGCACCGGCTGTTGCTCCTATCATATTTCCAGTACAGGTTAATAAGTCAAGAGAGAATCCAACTCTGTTTCGACATGATCATGC
GAATTCATCGATGCTAGTTGGTCCTGTTCCTATGTTTTCAATGCCTAATCCATCAAAATCGATCGACCTTAACGCCAACCACAATTCAACAATCG
AGCCATCGTCGTTGTCACTGAGATTATCATTGTCACTTGATCAGGGACAAGCATCATCTACTAGACACTCGGCATATAATGTGATGTCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294176] SGN-U580013 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T106019 [Download][View] Facility Assigned ID: TMEBZ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5