EST details — SGN-E295634

Search information 
Request: 295634Match: SGN-E295634
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83510Clone name: cLET-25-A12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191040 [TUS-61-P14] Trace: SGN-T342144 EST: SGN-E541269 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295634Length: 315 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295634 [] (trimmed) CACATTCCGTTATCCGTATTGAATTCCGTGATCGCTGTGTGTAAATTGCCACCTGATTTGTTCCCGGAGAAGGAAGTGTCTGCAACTCGAGTCTC
TGTAAGTGTTGGACTAATGAATTTGGTGGGTTCGTTGGTTTGGGGCAATGCCGTGTTGCCACCGTGCAGGGGGGCTGGCTGGACAGAATAGATTT
GGTGGGAGGAGCGGTGCATCCGTGGCGTAACTTGGATCGGGTAAATGGGGTCTTGGTTCGGTATTTCGGAGTTCATTTGAGAGGATCCTGAGTCA
TTTCCCTATGGGTATACTCGGGGTCCTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295634] SGN-U595726 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108359 [Download][View] Facility Assigned ID: TMEDT06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0252 Quality Trim Threshold: 14.5