EST details — SGN-E295848

Search information 
Request: 295848Match: SGN-E295848
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83740Clone name: cLET-25-P14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191063 [TUS-62-A13] Trace: SGN-T342181 EST: SGN-E541306 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191063 [TUS-62-A13] Trace: SGN-T349403 EST: SGN-E548528 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295848Length: 308 bp (759 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295848 [] (trimmed) TGGTGATACAATTAGAGGATTTACATCTTCTGACCAGGCATGGATCACATTGATCGGAGAGAAGTTAGATGCTACACTGACAAAAGTTATTTGAC
ATTCATAGTGGCAGTGCAAAATGGATGTTTTAAGATATTCTAACAGCAGTATCATAAGTTCAAGTGTTTGCTATAATCATGTCTAAATTCAAAGC
GATTTTCCTTCCTTTAGTTTATGTTGCACAAATGGGCATGCATTCTAGACAATAAATATGTATCATCTCTTGACTCTTATATTTGGACTCCCTCT
CCAAAAGGAGGACTTGCAGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295848] SGN-U565353 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108573 [Download][View] Facility Assigned ID: TMEDV91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0111 Quality Trim Threshold: 12.5