Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E296882

Search information 
Request: 296882Match: SGN-E296882
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83792Clone name: cLET-26-C23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191070 [TUS-62-A20] Trace: SGN-T342193 EST: SGN-E541318 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191070 [TUS-62-A20] Trace: SGN-T349405 EST: SGN-E548530 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296882Length: 261 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296882 [] (trimmed) GTAAGTGGAAGGTACAAGCTGCTGCTGCAATAAAAGCTGGGGCAGAAGGGGTTCGTTCAGTAATATTAAAGGGTGGAGGGGTGCTAACATTGGGG
AAGATTTACATATGGGTTAGCCAGTACATTTTCATGAAAGATGCTATTGCAGGCTGCCAACTATCACATTATGAAGGAAGTTCTTAAAAAGGATG
GAAAAGTTGCGGCTCTTAACCTGGAGTCCACATTGGCCTTGCTGGCTGAAAAACACGACTTAACCGGTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296882] SGN-U595180 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108934 [Download][View] Facility Assigned ID: TMEDW24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0326 Quality Trim Threshold: 14.5