EST details — SGN-E298862

Search information 
Request: 298862Match: SGN-E298862
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86804Clone name: cLET-44-F2
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179869 is on microarray TOM1: SGN-S1-1-6.3.1.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179869 [TUS-32-O3] Trace: SGN-T185781 EST: SGN-E373118 Direction: 3' Facility: INRA
Clone: SGN-C179869 [TUS-32-O3] Trace: SGN-T185782 EST: SGN-E373119 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298862Length: 424 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298862 [] (trimmed) GCGGACTTTTTGGGTCGTAGGCCCCGGGGCCGAGAGGGAGAAAACTCTAAAGCAATCAGGATTACTTGTTGGTCCTAAAATTCTCGTCTCTCTTC
CACTCCTCCCCTCCTTCCTATCTCTCTCATTTCAGAGACACGCTCCTCTCCATTAAATTTCCAACTAAGAACCCACTAACGGTGATTAACCTCCG
TTCCACTCTCTCCTTATTTCCTCCTATCATAATTAAACTTACGCTCCCCACCCTAATTTTACCAAAATTTACTCTTTCCCTCCTTCTCCCACTCT
CCAAAAAGATTATCATTTAACCTTTACTCACCGACCTCGCAGCGGTCGTCTCGTAAGACGACGATAGTAGCGCCGGTTCCGAAGACAAAGAATAA
GGCGGGGAAGTGTCCAGTCACGACCCCGTAAGCGCCGGCGACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298862] SGN-U601556 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111498 [Download][View] Facility Assigned ID: TMEGT25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0046 Quality Trim Threshold: 20.5