EST details — SGN-E299909

Search information 
Request: 299909Match: SGN-E299909
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90111Clone name: cLEW-1-L14
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191342 [TUS-62-M4] Trace: SGN-T342660 EST: SGN-E541785 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191342 [TUS-62-M4] Trace: SGN-T342663 EST: SGN-E541788 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299909Length: 550 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E299909 [] (trimmed) GGAGAGAACTGCAATACTTGTTTTCTGTTCAATTCCGGCTTGGTCTTTTTGATGGAAACCCTGCAAAGGGACAGTTTGCAAAATTTGGTCCTCAA
GATGTCTGTACTTCTAATAACTTGGAGTTGGCGCTTGATGCTGTGAGGCAGGGCATTGTGCTTCTTAAAAATGATCAGAAGTTCTTGCCATTGGA
CAAGAGAAGAATTTCTACATTAGCTATTGTCGGTCCTATGGCAAATGTGAGCAGTCCTGGTGGTACTTACACAGGCGTGCCGTGCAAATTAAAGA
GCATACGTGATGGGTTTCACCGTCATATAAATAGAACACTTTATGCAGCTGGTTGCCTGGACGTAGGATGCAATTCCACTGCTGGTTTCCCGGAT
GCTATTTCTATTGCTAAAGAAGCTGATTATGTAATTGTTGTGGCTGGGTTGGATTTATCCCAGGAAACTGAGGATCTTGACCGGTATAGTCTTCT
CTTACCAGGTCATCAGACAAACTTAGTTAGCGCTCTTGCAGCTGTAAGTAAGAAACCAATCATTTTGGTTCTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299909] SGN-U562658 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112139 [Download][View] Facility Assigned ID: TRDAD67THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5