Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E300088

Search information 
Request: 300088Match: SGN-E300088
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89035Clone name: cLEW-11-G6
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191540 [TUS-63-E10] Trace: SGN-T343000 EST: SGN-E542125 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191540 [TUS-63-E10] Trace: SGN-T343003 EST: SGN-E542128 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300088Length: 427 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300088 [] (trimmed) GGAATAAACCACTATGGCACTCTGTATGCGAAAGATTGCATTAATTCTAGCTGCGTTTGCTCCAATTCTAGTTGCATCGCGGGTGGAGACCACCC
TATCCATGGCTATCTCATTACTCTAGGAGAGAAAGATGGCGTTTCTATTGGAGAACCGGTATGAAGTTGTTTTTGTAATCCTTAAACTCTGCTTT
CTCTCGTCATGATACGCGTACTGTCCTGTTCTCCATAGACAGGAATGTCTCGATTTTTCGTGGTTCCAAATGGAATGGAGGAGATTGTTGACTAT
ATGAAGAAGAGATACCATAATAAACCTATGTTTGTTACTGAAAATGGCTACGCCTCTCTGAATCCTACTACAGCACAAGCGGATGAGCTACAACA
TGATACTAAGCGAGTTGAATTCCATAAGTCATATCTTGCATCATTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300088] SGN-U579567 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112928 [Download][View] Facility Assigned ID: TRDBP39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5