EST details — SGN-E300241

Search information 
Request: 300241Match: SGN-E300241
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89453Clone name: cLEW-17-F15
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300241Length: 234 bp (853 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E300241 [] (trimmed) GTGCTTACAAAATAGATTGGCGGAGGATGGATACTCCGGAGTTGAATTACAGGATACTCCCGTGCGAACTGATGCCTTCATAATGGCCACTCGTA
CTCAGAACGTTCTTGGTGAAAAAGGTAGGAGAATTAGGGAGCTGACTTCAGTTGTTCAGAAGCGGTTTAATTTCAAGGAAAACACTGTTGAGCTC
TATGCAGAGAAAGTCAACAATAGGGGTCTCTGTGCCATTGCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300241] SGN-U592830 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113289 [Download][View] Facility Assigned ID: TRDCO32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0101 Quality Trim Threshold: 20.5