Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E300251

Search information 
Request: 300251Match: SGN-E300251
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89531Clone name: cLEW-17-L19
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191649 [TUS-63-I23] Trace: SGN-T343190 EST: SGN-E542315 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191649 [TUS-63-I23] Trace: SGN-T349568 EST: SGN-E548693 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300251Length: 182 bp (847 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300251 [] (trimmed) CTTCATTGGGATTCATTCAAGACCCATGTGATCTACTATCCACCTAGCCATGAGGAGGAAAGTACATCTTGGCAAACCCCACTGACTCTGGAGTG
CTCTATTGGATAACCACTGCGCTGGATGTCGACCCCGTTACCACTGTCTGATATGATCAAAACTGTCACTTTCAGTTACATCAATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300251] SGN-U595200 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113299 [Download][View] Facility Assigned ID: TRDCO70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0259 Quality Trim Threshold: 12.5