EST details — SGN-E300251
| Search information |
| Request: 300251 | Match: SGN-E300251 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C89531 | Clone name: cLEW-17-L19 |
| ||
| Library Name: cLEW | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C191649 [TUS-63-I23] | Trace: SGN-T343190 | EST: SGN-E542315 | Direction: 5' | Facility: INRA (MWG) |
| Clone: SGN-C191649 [TUS-63-I23] | Trace: SGN-T349568 | EST: SGN-E548693 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E300251 | Length: 182 bp (847 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E300251 [] (trimmed)
CTTCATTGGGATTCATTCAAGACCCATGTGATCTACTATCCACCTAGCCATGAGGAGGAAAGTACATCTTGGCAAACCCCACTGACTCTGGAGTG
CTCTATTGGATAACCACTGCGCTGGATGTCGACCCCGTTACCACTGTCTGATATGATCAAAACTGTCACTTTCAGTTACATCAATAA
CTCTATTGGATAACCACTGCGCTGGATGTCGACCCCGTTACCACTGTCTGATATGATCAAAACTGTCACTTTCAGTTACATCAATAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E300251] | SGN-U595200 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T113299 [Download][View] | Facility Assigned ID: TRDCO70TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.949 | Expected Error Rate: 0.0259 | Quality Trim Threshold: 12.5 |
Working
