EST details — SGN-E300954
| Search information |
| Request: 300954 | Match: SGN-E300954 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C91660 | Clone name: cLEW-8-B15 |
| ||
| Library Name: cLEW | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C191397 [TUS-62-O11] | Trace: SGN-T342755 | EST: SGN-E541880 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C191397 [TUS-62-O11] | Trace: SGN-T342757 | EST: SGN-E541882 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E300954 | Length: 244 bp (1052 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E300954 [] (trimmed)
AAACTTTTTAATTATTCACAACAACGGGGTGGTTTTCTCAAAAACTCCTTCTGATCATTCTGTACACTCCACATTAGCTTCTAGCTATGTTCGAA
CTTCACTACCAAGGTTTGAGATGCTATAGAAGTCTATACCAAAAGAGGCAGCATACCAAATGATTAATGATGAGTTAATGCTGGATGGGAATCCA
AGGTTAAATTTGGCATGATTTGAAACCACATGGATGGAACCAGAATGTGATAAG
CTTCACTACCAAGGTTTGAGATGCTATAGAAGTCTATACCAAAAGAGGCAGCATACCAAATGATTAATGATGAGTTAATGCTGGATGGGAATCCA
AGGTTAAATTTGGCATGATTTGAAACCACATGGATGGAACCAGAATGTGATAAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E300954] | SGN-U578934 | Tomato 200607 | Build 2 | 18 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T112559 [Download][View] | Facility Assigned ID: TRDBE08TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.942 | Expected Error Rate: 0.0272 | Quality Trim Threshold: 14.5 |
Working
