Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E302371

Search information 
Request: 302371Match: SGN-E302371
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91452Clone name: cLEW-27-K22
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192049 [TUS-64-J15] Trace: SGN-T343881 EST: SGN-E543006 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192049 [TUS-64-J15] Trace: SGN-T349682 EST: SGN-E548807 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302371Length: 576 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302371 [] (trimmed) GCCAGTTCTTTCTTTTCAATTTCCCCAAACCCTAGAACTGGAAAATCTAAGTAAATGGGTCGTCTTGTTTCTTGATTTTAATATCTGGGTCGTTT
TTTTAGTTCTCGTTTTGCGTATCAGAATCTTCAAACAAGTTCATTTGCTGCAGAAAAAAGGAGCAATTTTTAATATTTTTATCTTCAATATTAGT
AGTTCATTCACATTGGTGGAAGTTGGTTTGTTGGCATTTGTTTTTTATGGTTTGAGTTGAAACGGGTCGGACTCGGTTCTCTATGGCTCGGCGTC
ATGGGTGGCAACTACCGGCTCACTCGTTTCAGGTTGTGGCTATAACAGTTTTCTGCCTGCTATCTGTTGGCTTCTATGCATTTTTTGCTCCATTT
CTAGGAAAAGACATCTTTGAGTACATAGCAATTGGTGTTTATTCCTTCCTGGCTCTATGTGTGTTCATACTCTATGTTAGATGCACAGCAATTGA
TCCTGCTGATCCTGGGATTCTCATTGAAGCTGACAAGTCAACGGCCTATCAATCACACAACGAAATAGAGTTGCCTGGTGATATATCTGCTGCAG
GGGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302371] SGN-U602677 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114954 [Download][View] Facility Assigned ID: TRDEB71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5