EST details — SGN-E302715

Search information 
Request: 302715Match: SGN-E302715
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97136Clone name: cLEY-1-A3
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192634 [TUS-66-B24] Trace: SGN-T344886 EST: SGN-E544011 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192634 [TUS-66-B24] Trace: SGN-T349847 EST: SGN-E548972 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302715Length: 323 bp (901 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E302715 [] (trimmed) NAATTTGGACAAGAACACTTCAAATACTCATTTCCCTTCCAACTCCACTCAATCATAGGGGAAAGTTTGATTGTATAACATTGTGTAGAAATGAA
AAATGTGAAAAGAATTAAAACAAAATCCTTAAATCCCCTCTTTAGTTCATCCGCCAAAGAAAAAATTTACCTAATCGATCCTTCAGAAATGGATG
TGACCTTGCAAACACCAACAGAAGTGGTGAGTGGCAAATCTTTATAGCAAGCAACCAACTCCTTATTTGTGTGCAGATCCACCTGAAGAGTTTCC
CAAACCTTCTTCTTAGGATTCAAGACATCATCCGCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302715] SGN-U564301 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118398 [Download][View] Facility Assigned ID: TRYAA02TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0132 Quality Trim Threshold: 12.5