EST details — SGN-E302865

Search information 
Request: 302865Match: SGN-E302865
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91192Clone name: cLEW-26-E7
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191979 [TUS-64-G17] Trace: SGN-T343761 EST: SGN-E542886 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302865Length: 442 bp (1405 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E302865 [] (trimmed) TTTGCTATTGATATACGAAACATCTCACTTATGGTTTTTTTTAGTTACGAAATATTTATTTTGATATATTCTAGGAGTTTTTTATTTTCTTAAAT
TTCGTGCCAAAATTGTTTCATACCAATAAATTACTGAAATGATTGGAGTTGGATGCTTTTTAGCAGACAAATTTGACTAAAATAATTTTGATTTA
CCAAACTTAAAGTTATTGTTAATGGTCCATTATAGCCGATATAGTTGTTCAAATCATTTTTAATAAAAGCAATTTTGAAATAGTTTCTTTGCTTC
CTATTCACAACTTTAGAATCAGGATCTGGTTCATGCATTTCACATCAATCTTTCTTATATTCCATTCCAATTCAGTTGGATCACTACATCCTAGC
TTTTTTTTTTTCGAAAGGGGAAATGAGGTAGGAGAGAATAAGGTGGTAAATCGAGCTTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302865] SGN-U565740 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114697 [Download][View] Facility Assigned ID: TRDDW28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.904 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5