Notice: Due to a wide-spread power outage in the area, SGN was unavailable early on Sunday. We apologize for the inconvenience.

EST details — SGN-E304887

Search information 
Request: 304887Match: SGN-E304887
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92157Clone name: cLEX-10-E4
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192334 [TUS-65-F12] Trace: SGN-T344370 EST: SGN-E543495 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304887Length: 540 bp (911 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304887 [] (trimmed) GCTTTATGTTAACAATTTTCCTGCATATTCAGTAAAGCATTTGTACAAACACATAGATCTGCAATTTTACATTCTCCAGTTGGATCGCCAGTTTC
CGATCTGGAAACAATAGGCCGGAACCCACTTTGTTTTTCATCTAAAATTCTTTACACACAATTATAGTTAGATAATTGATAAACAAACCCGATAT
ATATAAATTTTATTTTTTTTGGTTGAAATGGCTGACATCAATGTTAACTCAGTGTTGACTTCGGGGGAAGATATGGCGGAGAAAGCATTGAGCAA
GAGATATGAAGGGTTAGTTGCTGTCCGTACAAAAGCTATAAAAGGGAAAGGAGCTTGGTACTGGGCTCATCTGGAGCCTGTTTTGATTCAAAACC
CGGAAACGAATCATCCAAAAGCAGTGAAACTTAAGTGCACTTTGTATGATGCTGCGTTTTCGGCTTCAAATCCGTCACGGACTGCTACAGAGCAT
CTAAAAAGAGGTACTTGTCCCAATTTTGGCGCTGTTTTGAGGCCCATTTCACAGTTACCCCCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304887] SGN-U599391 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116661 [Download][View] Facility Assigned ID: TRXBL26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0196 Quality Trim Threshold: 14.5