EST details — SGN-E305789

Search information 
Request: 305789Match: SGN-E305789
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93234Clone name: cLEX-14-B21
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192539 [TUS-65-O1] Trace: SGN-T344722 EST: SGN-E543847 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192539 [TUS-65-O1] Trace: SGN-T344723 EST: SGN-E543848 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305789Length: 334 bp (433 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305789 [] (trimmed) GCTTCTACGTCGCAGTTGCTCTGCTAATTTGTTGAGCTTGAAGCAGATTTTTCCTTGAGTTGCCATGAACACGTCTTGTGGAGCAAATTTGGAAC
TATCAAGATGCATTGCTGCATCCCCTGTTTGTCGTTTAAAATCTTCTATCTTTGAGTTAAGATCATGTATACCCAAGCTACAAGGCCTCTCAAAG
AAGCTATTGCCTTTATGCAAAGATATAAATGCTAGAAGTAACAAGGAGAGAAGCATTCCATTCTCTGTTACTTGTAGTGGCAGTCAGGTTGACAC
TGCTGCAGATGAGCCCAGCAGTCTTACATATAAGGATGCTGGTGTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305789] SGN-U581127 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118275 [Download][View] Facility Assigned ID: TRXCC11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5