EST details — SGN-E306578

Search information 
Request: 306578Match: SGN-E306578
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93077Clone name: cLEX-13-J6
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192508 [TUS-65-M18] Trace: SGN-T344669 EST: SGN-E543794 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306578Length: 470 bp (898 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306578 [] (trimmed) TCGATATAAGACAGAGGAGTATTCCACTGAAGCCACTAACAAATTCAACATCTACCCTGAACAAATCCCTCATTGGTTGATGGACTGGATTCCTG
AGGAAGGTGGTTATCTTATTGGCAATTTACAACCTGCCCACATGGACTTTAGATTCTTCACACTTGGAAATTTGTGGTCCATTGTGTCGTCTTTG
AGTACCCCAAAACAGAATGAGGCTATCCTGAATCTGATTGAAGCAAAGTGGTACGATCTTGTGGGTCTTATGCCCCTTAAGATATGTTACCCTGC
TCTGGAGTCTGAAGATTGGCGTATAATCACTGGTAGCGACCCTAAGAACACACCTTGGTCATATCATAATGGGGGTTCTTGGCCAACTCTTCTCT
GGCAGTTCACGCTGGCATGCATCAAGATGAATAGGCTTGACCTGGCTAAGAAGGCAGTGGATTCAGCTGAGAAAAGGCTTGGGGTGGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306578] SGN-U583273 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117671 [Download][View] Facility Assigned ID: TRXBZ51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5