EST details — SGN-E307529

Search information 
Request: 307529Match: SGN-E307529
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97932Clone name: cLEY-24-H19
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307529Length: 433 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E307529 [] (trimmed) GGTGGTTTGAGGTACACAAATGCACAGGTAAGTAAACTGTTACAACGCAAGGTAAATTGCTTAGAAGTAAAGAGTATCCCTGAAGCAGAATTAAA
CTATCCTTCGTTTTCCATATTTGGACTTGGATCAACTCCTCAGACATACACAAGAACTGTGACCAACGTTGGTGATGTTGCATCATCTTACAAAG
TGGAGATAGCTTCACCTATAGGAGTTGCCATAGAAGTTGTACCCACAGAACTAAATTTCTCCAAGTTGAACCAGAAGTTAACATACCAAGTGACA
TTTTCCAAGACAACCAGCAGTTCAGAAGTTGTGGTTGTTGAGGGATTCTTGAAGTGGACTTCTACTAGGCACTCTGTGAGAAGTCCAATTGCAGT
TGTATTGGTCTAGTGAAAAATTGGCTATATATATAAGTGCATAAAGTACTCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307529] SGN-U592426 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121337 [Download][View] Facility Assigned ID: TRYDQ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0006 Quality Trim Threshold: 12.5