EST details — SGN-E307569

Search information 
Request: 307569Match: SGN-E307569
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96444Clone name: cLEY-16-A19
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192932 [TUS-66-O10] Trace: SGN-T345397 EST: SGN-E544522 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192932 [TUS-66-O10] Trace: SGN-T345398 EST: SGN-E544523 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307569Length: 256 bp (968 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307569 [] (trimmed) GGTTTCGAATTTTTCACCTTCTGTATCGAAAATGAAGGAGTGCATTTCAATCCACATTGGTCAGGCCGGTATTCAGGTCGGAAATGCTTGCTGGG
AACTTTACTGCCTCCAGCACGGCATTCACCCTGATGGCCAGATGCCACGTGACAAAACTGTTGGAGGGGGTGATGATCCATTCAACACCTTCTTT
CAAGAAACTGGAGCTGCAAAGCATGTTCCTAGAACTGTCTTTATAAATCTTGAGCCCACTGACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307569] SGN-U591509 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119923 [Download][View] Facility Assigned ID: TRYCI10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0298 Quality Trim Threshold: 14.5