Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E307930

Search information 
Request: 307930Match: SGN-E307930
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97321Clone name: cLEY-20-P18
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193103 [TUS-67-F13] Trace: SGN-T345691 EST: SGN-E544816 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193103 [TUS-67-F13] Trace: SGN-T345692 EST: SGN-E544817 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307930Length: 347 bp (958 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307930 [] (trimmed) GTCCAAAGAAAGAAAAGGCAATACATTTGTGTTTTCTGCAACCATTGCTTTGTCTGCCGATTTCAGGAAGAAGCTAAAGCGTGGATCACAAAAAT
CAAAAGCAAACGATGAGTTGAATTCAATAGAAACTCTGTCTGAGAGAGCAGGAATGAGGGCAGATGCGGCAATCATTGATCTGACTAATGCATCA
ATTCTAGCCAACAAGCTCGAGGAGTCGTTTATAGACTGCAGGGATGAAGATAAAGATGGGTATTTGTATTACATTTTGAGTGTTCATGGACAAGG
TCGGACAATTGTCTTCTGTACGTCCATTGCAGCTTTACGCCATATCTCCTCCCTCTTGCGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307930] SGN-U600567 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120740 [Download][View] Facility Assigned ID: TRYDB93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5