EST details — SGN-E308265

Search information 
Request: 308265Match: SGN-E308265
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100304Clone name: cLEZ-6-K11
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193313 [TUS-67-O7] Trace: SGN-T346052 EST: SGN-E545177 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193313 [TUS-67-O7] Trace: SGN-T346053 EST: SGN-E545178 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308265Length: 326 bp (397 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E308265 [] (trimmed) GGAACTTCACAGGAAGTTTGTTGCAGCTGTTGGTCAGTTGGGCATCGAAAAAGCTGTGCCAAAGAGGATTCTTGACTTGATGAATGTTGACGGGC
TTACAAGGGAAAATGTGGCAAGCCATCTGCAGAAGTATAGGCTTTACTTGAAAAGGATCAATTCAGTTCAAACCCAACAAGCAAACATGGTTGCC
GCATTAGGGGGAAGGGACTATGTGCGAATGGGCTCACTGGATGGGCTTGGAGATTTTCGAACATTGGGTGGATCAGGACGGTATACTCATGCTGC
CTTGTCATCGTACAGTTCAGGGGGCATGCTTGGCAGACTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308265] SGN-U604805 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121873 [Download][View] Facility Assigned ID: TRZAU66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5