Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E308418

Search information 
Request: 308418Match: SGN-E308418
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98028Clone name: cLEY-25-J17
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308418Length: 431 bp (1052 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308418 [] (trimmed) CTACTCTCTCCCCATCTGGTAATTTCTTCAATCCACAAAATCCTGTTGCTAGCCAACTAACTGGGAAATCGGAGGCAATGAACTACTCTTTGCTT
ATGGATGCATCAACTAATGTTTCAGCACCCTATGACCTATCACTGATTGATGTAGATATTTCAACTTATCCATCTAAGGTACCTGCAGCCAATCC
TGGGTCAAGAGTGATGCTATTGAATTTTTCAACCATGTGTGGATTCATTTTGTTTGGGAATTAGATATGGCCAGCGTCACACGTGAAACTGAGTA
TGTCGCTGTGAAGCTCACAGTTGTAACTTTAGTTTGTAAATGTAGGCAAAGCTAGTTTTCTACCATGTACTTTTGATTGAGTGCTCCCATTTCCA
TATGTAGTGTAATTAAAGAAAACCTCAGTTATGTTACATTTGGATGAGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308418] SGN-U563569 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121681 [Download][View] Facility Assigned ID: TRYDU57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0309 Quality Trim Threshold: 12.5