Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E310349

Search information 
Request: 310349Match: SGN-E310349
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C113089Clone name: cTOA-1-C16
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310349Length: 379 bp (929 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E310349 [] (trimmed) GGACTGCAGGGTGGATTGTTAAAGTTAGTAACAAAGCATATTTTGAGCTTTCCCTAACTGGGGAAATGATATTGTTTGATCCATCAAAGGGAAAA
ATTGTTTGGCAAAGCAAAACTGGCAACACATCTGTTGAATCAGCTGTTCTTCTTGATGATGGCAACTTTGTCCTTTTAAATAGGAATAAGAGTAC
TGTTTGGCAGAGTTTTGAAAGTCCATCTGACACAATACTGTCTGGCCAGAGTTTATCTGTAGGCCAGTCTCTTCGAGCTTCTAGCAGGAGTTCTT
TAACAAGTTATTACAGTCTTCATATGAATGTTTCTGGTGAGATGCAGCTTAGGTGGGAGACTAGTATCATTTACTGGACTGTTGGGGGTCCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310349] SGN-U601607 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124272 [Download][View] Facility Assigned ID: TFAAB20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5