Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E314298

Search information 
Request: 314298Match: SGN-E314298
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C113597Clone name: cTOA-21-C2
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E314298Length: 415 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E314298 [] (trimmed) GCTGACTTCCTCCAGGAGGTTACGTCGAAAAAGGATCAAGCACAGTATTGGCATGAAACTAAAGAAACATATAAATTTCTGTCAGTTGATACATT
ATCAAGAAAGTTTAAGGAATCTCCATACAGGAAAAAGCTGAATGATGAACTTTCTGTTGCATATGATAAGTCCAGGTGTCATAAAAATTCTATAA
CCTTTCGTGACTATTCACTTCCTAAATGGGAACTCTTTCGAGCTTGTATGTCAAGAGAATTCCTTCTGATGAAAAGGAATTCTTTTATCTACATA
TTCAAAACTGTTCAGCTTGTCATCATTGCATTCATAACTATGACCGTATTTTTGAGAACTCGGATGCATACTGATCTTGTACATGCAAATTATTA
TTTGGGAGCTCTGTTTTTTGCTCTCATCATTCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E314298] SGN-U599430 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T127246 [Download][View] Facility Assigned ID: TFADD13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5