Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E315759

Search information 
Request: 315759Match: SGN-E315759
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C115370Clone name: cTOA-26-O10
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E315759Length: 454 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E315759 [] (trimmed) GAGGTGAAGGGAAAGAGGTGTGGTGCCAATCTGAATTCAGTATTCTATGCAGAATCATACCATCCAATTCAAGCTGGAAGCATCGATGGCACTGA
CATCCTTCCACATGATAACGCCATTTACAGAGCTCTTCTTGGCTCTAATGCCGGATTGTATGACCCTTTTGGTGACCCAAAGGCTATTGGTGATC
CTTATTCTACTCTCTTTGTTGGCCATTTGTCTCACTTGACCACTGAACACACTCTTCAAAAGGAAATGAACAAGTATGGAAAGGTGAAGAACTTA
AGAATTGTTAGACACATTGTAACAGGTGCTTCACGCGGTTATGCATTTGTGGAATTTGAAACTGATAGAGAAATGCGTCGAGCATACACGGATGC
TCATCATAAGGTTATTGATGATTCTGAAATAATAGTGGACTACAACAGGCAAAGGTTAATGTCAGGCTGGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E315759] SGN-U601583 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T128715 [Download][View] Facility Assigned ID: TFADX89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5