| SGN ID: SGN-C116495 | Clone name: cTOA-30-A17 |  | Order Clone |
|
| Library Name: cTOA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E317730 | Length: 246 bp (879 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E317730 [] (trimmed)
CTTAGGCAAATGTTTCTTTCCATGACAGAGGAGGTCCGTGTTATAATTGTCAAATTAGCTGATAGATTACATAACATGCGCACTCTTTCACATAT
GCCTCCACACAAGCAGTCTGGAATAGCAACAGAGACGCTGCAGGTTTTTGCTCCTTTGGCAAAACTTCTCGGAATATACCAAATCAAGTCAGAGC
TTGAAAACTTGGCATTTATGTATACAAATGCTCAAGACTATGCCAGGGTGCAGCGC
[BLAST] [AA Translate]
| SGN-ID: SGN-T129947 [Download][View] |
Facility Assigned ID: TFAEM09TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.960 |
Expected Error Rate: 0.0027 |
Quality Trim Threshold: 14.5 |