EST details — SGN-E324070

Search information 
Request: 324070Match: SGN-E324070
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C127832Clone name: cTOC-3-E10
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E324070Length: 474 bp (946 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E324070 [] (trimmed) GCTATCGACTTGATCAAGCAACTCTGCTCGTGGGACCCATTGAGAAGACCAACTGCTGACCAATGCTTACAGCACCCATTTTTTCATGTTGATAT
GTCAATTCCTCGTCCTCTAGAGGATCCACTGCAGATGAATTTAAGTAGTGTTGGACCTGAGCCTAATCTTGAGTTGAACCTGTGGGATTTTGGGA
CAGAAAAAGATGACTGCTATCTTGGTTTGACTTTGGCTGTGAACCCAACTCCCTCTTGTCTAGATTTATTTCCAGCAAAGATGGCAAGTAAAAGT
CAAGGTGCAGGAACGGATATGTTCTGCTCTGGTTTCCAAGATCACTCGCAACACTCAGTTTTCTGGTCATTGTTTCCTACTGATCGCCATCAGAT
ATCTACTCCGGTGGACTCCTCATTGTCATTATCATTCAGCACGATTCCACAGTCAACTATTGGAGCTCCACAATCAACTAGTTTTGGCATGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E324070] SGN-U562672 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136643 [Download][View] Facility Assigned ID: TFCAJ29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5