EST details — SGN-E324187

Search information 
Request: 324187Match: SGN-E324187
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C128051Clone name: cTOC-4-D8
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182860 is on microarray TOM1: SGN-S1-1-7.3.5.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182860 [TUS-40-K18] Trace: SGN-T187878 EST: SGN-E375984 Direction: 3' Facility: INRA
Clone: SGN-C182860 [TUS-40-K18] Trace: SGN-T187879 EST: SGN-E375985 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E324187Length: 512 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E324187 [] (trimmed) AGTGGCTTTGCTACCTGCACTCCGCCATCTCTTCACCCACTTGCGTTCACCAGCCACATCCATAGCCTTGTCTATCTGCCCAAGATTGTCAATCC
CAATTCACACAACACTCTCTTCTCTCTTCCCTCTTTCTTCTTCTTCTTCTTCTCAACCTACTGCTAAGCATCATGCTATTTCTAAAGAGAGTACT
CTGGTGCTGAAACAAGACGAGAGGTTATCAGTGTCTGGTACAGTGAGCGCTCTTGACTCAGCCGTTAATACTAGCACCATTGCTGCTATTGTCAC
TTCTTTGGGTGGTCCAGCAGCTGCAGTTGGAATTATTCGGTTATCTGGTCCTTCTGCAGTGCCTATAGTTGGTCGTGTATTTCATCCCAAGGTGA
AAAAGAAGAAAAGGAGTTCTTCGGAGTGGAGACCGAGTAGTCATGTTGTAGAGTACGGTTTTGTTTCCGACTCTCATGGGAATGTGATTGATGAA
GTTCTGGTGGTTCCTATGCTGGCTCCAAAGTCTTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E324187] SGN-U568996 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136760 [Download][View] Facility Assigned ID: TFCAP16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5