EST details — SGN-E332726
| Search information |
| Request: 332726 | Match: SGN-E332726 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C130044 | Clone name: cTOD-18-C6 |
| ||
| Library Name: cTOD | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E332726 | Length: 152 bp (858 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E332726 [] (trimmed)
GGTTTAGCAGACATGAGGTGATTGTATATGAAGATGAAAATGACAAGCCCCCAGTTGGTATGGGGCTTAACAAGCCTGCTGAAGTAACTTTGCTG
CTGGAAGTACGGTCCTCCAAACACTATGACGTGGATTCTTCTAGAGGACTGGTGGAG
CTGGAAGTACGGTCCTCCAAACACTATGACGTGGATTCTTCTAGAGGACTGGTGGAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E332726] | SGN-U576936 | Tomato 200607 | Build 2 | 8 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T145340 [Download][View] | Facility Assigned ID: TFDCR15TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.960 | Expected Error Rate: 0.0028 | Quality Trim Threshold: 14.5 |
Working
