EST details — SGN-E336317
| Search information |
| Request: 336317 | Match: SGN-E336317 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C134643 | Clone name: cTOE-10-B17 |
| ||
| Library Name: cTOE | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E336317 | Length: 187 bp (900 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E336317 [] (trimmed)
TTCTAGGATAACCTAATTTCTCTCTCTGGGCATCTTTGCTTAAGCTTTCATACTCTCCTTTTTGCTTAGCAATGGCACACGGAATGATCAAAATC
CGCATCAACGGATTCGGTAAAATTGGTCGATTGGTGGCTCGAGATGCTCTACAGAGAGAGGATGTTGTACTAGTTGCAGTGAATGATCCATT
CGCATCAACGGATTCGGTAAAATTGGTCGATTGGTGGCTCGAGATGCTCTACAGAGAGAGGATGTTGTACTAGTTGCAGTGAATGATCCATT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E336317] | SGN-U591319 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T149663 [Download][View] | Facility Assigned ID: TAIBM09TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.968 | Expected Error Rate: 0.0324 | Quality Trim Threshold: 14.5 |


