Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E336661

Search information 
Request: 336661Match: SGN-E336661
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C138419Clone name: cTOE-4-D18
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336661Length: 203 bp (990 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E336661 [] (trimmed) GATTCTTTGTGCTTCCTTCAATCAAGACAACAGTTGCTTTGCTATTGGAACAAGGGAAGGGTTCAAAATTTTTGATTGTAATACTGGAAGACTAC
TTTATGAAAGAGTTGCTGGAGCATTTATTATAGTTGAAATGTTGTTTAGCTCAAGCCTTCTCGCAATTGTTGGAGCTGGTGAACAAGCGTTTCTG
TCGACTCGAAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336661] SGN-U573522 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148319 [Download][View] Facility Assigned ID: TAIAP21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5