Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E338342

Search information 
Request: 338342Match: SGN-E338342
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135257Clone name: cTOE-13-D16
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338342Length: 265 bp (1042 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338342 [] (trimmed) GCTTGTTGGTGTTCTTCTACATCAACACCATCTTGTAGGGCTTCTCTTAGGGCATACCAGAAGCTTGTTGAAGCTGGATTCTCCTTCCTTCTTTC
TTCCCGTATCTCACCAACCCTGGTTCACTGGTTTCATCGATTAATCCTTAAGAAACAACTTTTTTCAATCTCCCTTTACCGTCTCTACTGAAACC
CTGATCTGTATTGTGAATTACCGGATAAAAACCGTATCTTTAGGGTTCCTGGGATCTGGGTCCATCTGGCTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338342] SGN-U595485 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150355 [Download][View] Facility Assigned ID: TAIBZ20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0333 Quality Trim Threshold: 14.5