Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E343160

Search information 
Request: 343160Match: SGN-E343160
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141642Clone name: cTOF-17-D5
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E343160Length: 469 bp (935 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E343160 [] (trimmed) GGTGGTGTTAAGAAGCTTAAGACTGACAAACCCTATGGAATTAATGGAAGCATGGCCTTGAGAGATGGGGTTGATGCCTCAGGCAGGAAGCCCAA
GGGAAAGGGTGTGTACCAATATGTTGACAAATATGGAGCTAATGTTGATGGATACAGTCCCATCTACAACACGGATGAATGGTCTCCAAGTGGTG
ATGTCTATGTTGGAGGTACCACTGGCTTAGCCATATGGGCGGTGACCTTGCTTGGCATTCTTGCAGGAGGTGCTCTCCTTGTCTACAACACAAGT
GCTTTGGCGCAATAGATGTTATCCTTGTATTGTACTATTAAGTTTAAGTTGTATTCCATGTTATCTTTTCAAAATATTTCTTGGCATCTTCATTA
ATATGTAATTGCTGTGATTTTACTGTGGATAATATTACATCTAATGTTGCTGTTTTAGGTTCTTATAAATCTTTTAAGTTTAGNTCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E343160] SGN-U581090 Tomato 200607 Build 2 465 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T157025 [Download][View] Facility Assigned ID: TOFCO15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0041 Quality Trim Threshold: 12.5